| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406924 |
Name | MIR134 |
Synonym | MIRN134;microRNA 134;MIR134;microRNA 134 |
Definition | hsa-mir-134 |
Position | 14q32.31 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406924 |
Links to all GeneRIF Items | 406924 |
Links to iHOP | 406924 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406924 : length: 22 tgtgactggttgaccagagggg |
Protein Sequence | >406924 : length: 3 N/A |