| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406925 |
Name | MIR135A1 |
Synonym | MIRN135-1|MIRN135A1;microRNA 135a-1;MIR135A1;microRNA 135a-1 |
Definition | hsa-mir-135-1|hsa-mir-135a-1|microRNA 135-1 |
Position | 3p21.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406925 |
Links to all GeneRIF Items | 406925 |
Links to iHOP | 406925 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406925 : length: 23 tatggctttttattcctatgtga |
Protein Sequence | >406925 : length: 3 N/A |