| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406926 |
Name | MIR135A2 |
Synonym | MIRN135-2|MIRN135A2;microRNA 135a-2;MIR135A2;microRNA 135a-2 |
Definition | hsa-mir-135-2|hsa-mir-135a-2|microRNA 135-2 |
Position | 12q23.1 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406926 |
Links to all GeneRIF Items | 406926 |
Links to iHOP | 406926 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406926 : length: 23 tatggctttttattcctatgtga |
Protein Sequence |
>406926 : length: 3 N/A |