| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406934 |
Name | MIR142 |
Synonym | MIRN142;microRNA 142;MIR142;microRNA 142 |
Definition | hsa-mir-142 |
Position | 17q22 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406934 |
Links to all GeneRIF Items | 406934 |
Links to iHOP | 406934 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406934 : length: 21 cataaagtagaaagcactact |
Protein Sequence | >406934 : length: 3 N/A |