| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406938 |
Name | MIR146A |
Synonym | MIRN146|MIRN146A|miR-146a|miRNA146A;microRNA 146a;MIR146A;microRNA 146a |
Definition | hsa-mir-146|hsa-mir-146a |
Position | 5q34 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 406938 |
Links to all GeneRIF Items | 406938 |
Links to iHOP | 406938 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406938 : length: 22 tgagaactgaattccatgggtt |
Protein Sequence |
>406938 : length: 3 N/A |