| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406939 |
Name | MIR147A |
Synonym | MIR147|MIRN147|hsa-mir-147a;microRNA 147a;MIR147A;microRNA 147a |
Definition | hsa-mir-147|microRNA 147 |
Position | 9q33.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406939 |
Links to all GeneRIF Items | 406939 |
Links to iHOP | 406939 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406939 : length: 20 gtgtgtggaaatgcttctgc |
Protein Sequence |
>406939 : length: 3 N/A |