| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406948 |
Name | MIR15A |
Synonym | MIRN15A|hsa-mir-15a|miRNA15A;microRNA 15a;MIR15A;microRNA 15a |
Definition | - |
Position | 13q14.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406948 |
Links to all GeneRIF Items | 406948 |
Links to iHOP | 406948 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406948 : length: 22 tagcagcacataatggtttgtg |
Protein Sequence |
>406948 : length: 3 N/A |