| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406950 |
Name | MIR16-1 |
Synonym | MIRN16-1|miRNA16-1;microRNA 16-1;MIR16-1;microRNA 16-1 |
Definition | hsa-mir-16-1 |
Position | 13q14.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406950 |
Links to all GeneRIF Items | 406950 |
Links to iHOP | 406950 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406950 : length: 22 tagcagcacgtaaatattggcg |
Protein Sequence |
>406950 : length: 3 N/A |