General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 406951 |
Name | MIR16-2 |
Synonym | MIRN16-2|mir-16-3;microRNA 16-2;MIR16-2;microRNA 16-2 |
Definition | hsa-mir-16-2 |
Position | 3q25.33 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 406951 |
Links to all GeneRIF Items | 406951 |
Links to iHOP | 406951 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406951 : length: 22 tagcagcacgtaaatattggcg |
Protein Sequence |
>406951 : length: 3 N/A |