General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 406953 |
Name | MIR18A |
Synonym | MIR18|MIRN18|MIRN18A|hsa-mir-18|hsa-mir-18a|miR-18|miRNA18A;microRNA 18a;MIR18A;microRNA 18a |
Definition | - |
Position | 13q31.3 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
Caution | This gene might be oncogene according to our integrated oncogene list. |
External Links |
|
Links to Entrez Gene | 406953 |
Links to all GeneRIF Items | 406953 |
Links to iHOP | 406953 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406953 : length: 23 taaggtgcatctagtgcagatag |
Protein Sequence |
>406953 : length: 3 N/A |