| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406954 |
Name | MIR181A2 |
Synonym | MIRN181A|MIRN181A2|hsa-mir-181a-2;microRNA 181a-2;MIR181A2;microRNA 181a-2 |
Definition | hsa-mir-181a |
Position | 9q33.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406954 |
Links to all GeneRIF Items | 406954 |
Links to iHOP | 406954 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406954 : length: 23 aacattcaacgctgtcggtgagt |
Protein Sequence |
>406954 : length: 3 N/A |