| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406956 |
Name | MIR181B2 |
Synonym | MIRN181B2;microRNA 181b-2;MIR181B2;microRNA 181b-2 |
Definition | hsa-mir-181b-2 |
Position | 9q33.3 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406956 |
Links to all GeneRIF Items | 406956 |
Links to iHOP | 406956 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406956 : length: 23 aacattcattgctgtcggtgggt |
Protein Sequence | >406956 : length: 3 N/A |