| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406958 |
Name | MIR182 |
Synonym | MIRN182|miRNA182;microRNA 182;MIR182;microRNA 182 |
Definition | hsa-mir-182 |
Position | 7q32.2 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406958 |
Links to all GeneRIF Items | 406958 |
Links to iHOP | 406958 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406958 : length: 24 tttggcaatggtagaactcacact |
Protein Sequence | >406958 : length: 3 N/A |