| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406961 |
Name | MIR185 |
Synonym | MIRN185|miR-185;microRNA 185;MIR185;microRNA 185 |
Definition | hsa-mir-185 |
Position | 22q11.21 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406961 |
Links to all GeneRIF Items | 406961 |
Links to iHOP | 406961 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406961 : length: 22 tggagagaaaggcagttcctga |
Protein Sequence |
>406961 : length: 3 N/A |