| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406963 |
Name | MIR187 |
Synonym | MIRN187|miR-187|miRNA187;microRNA 187;MIR187;microRNA 187 |
Definition | hsa-mir-187 |
Position | 18q12.2 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406963 |
Links to all GeneRIF Items | 406963 |
Links to iHOP | 406963 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406963 : length: 22 ggctacaacacaggacccgggc |
Protein Sequence | >406963 : length: 3 N/A |