| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406967 |
Name | MIR192 |
Synonym | MIRN192|miR-192|miRNA192;microRNA 192;MIR192;microRNA 192 |
Definition | hsa-mir-192 |
Position | 11q13.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406967 |
Links to all GeneRIF Items | 406967 |
Links to iHOP | 406967 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406967 : length: 21 ctgacctatgaattgacagcc |
Protein Sequence | >406967 : length: 3 N/A |