| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406968 |
Name | MIR193A |
Synonym | MIRN193|MIRN193A;microRNA 193a;MIR193A;microRNA 193a |
Definition | hsa-mir-193|hsa-mir-193a |
Position | 17q11.2 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406968 |
Links to all GeneRIF Items | 406968 |
Links to iHOP | 406968 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406968 : length: 22 tgggtctttgcgggcgagatga |
Protein Sequence | >406968 : length: 3 N/A |