General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 406969 |
Name | MIR194-1 |
Synonym | MIRN194-1;microRNA 194-1;MIR194-1;microRNA 194-1 |
Definition | hsa-mir-194-1 |
Position | 1q41 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
Caution | This gene might be oncogene according to our integrated oncogene list. |
External Links |
|
Links to Entrez Gene | 406969 |
Links to all GeneRIF Items | 406969 |
Links to iHOP | 406969 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406969 : length: 22 tgtaacagcaactccatgtgga |
Protein Sequence |
>406969 : length: 3 N/A |