| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406971 |
Name | MIR195 |
Synonym | MIRN195|miRNA195;microRNA 195;MIR195;microRNA 195 |
Definition | hsa-mir-195 |
Position | 17p13.1 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406971 |
Links to all GeneRIF Items | 406971 |
Links to iHOP | 406971 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406971 : length: 21 tagcagcacagaaatattggc |
Protein Sequence |
>406971 : length: 3 N/A |