| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406973 |
Name | MIR196A2 |
Synonym | MIRN196-2|MIRN196A2;microRNA 196a-2;MIR196A2;microRNA 196a-2 |
Definition | hsa-mir-196-2|hsa-mir-196a-2|microRNA 196-2 |
Position | 12q13.13 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 406973 |
Links to all GeneRIF Items | 406973 |
Links to iHOP | 406973 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406973 : length: 22 taggtagtttcatgttgttggg |
Protein Sequence |
>406973 : length: 3 N/A |