| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406975 |
Name | MIR198 |
Synonym | MIRN198|miR-198;microRNA 198;MIR198;microRNA 198 |
Definition | hsa-mir-198 |
Position | 3q13.33 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406975 |
Links to all GeneRIF Items | 406975 |
Links to iHOP | 406975 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406975 : length: 22 ggtccagaggggagataggttc |
Protein Sequence | >406975 : length: 3 N/A |