| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406982 |
Name | MIR20A |
Synonym | MIR20|MIRN20|MIRN20A|hsa-mir-20|hsa-mir-20a|miR-20|miRNA20A;microRNA 20a;MIR20A;microRNA 20a |
Definition | - |
Position | 13q31.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 406982 |
Links to all GeneRIF Items | 406982 |
Links to iHOP | 406982 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406982 : length: 23 taaagtgcttatagtgcaggtag |
Protein Sequence |
>406982 : length: 3 N/A |