| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406985 |
Name | MIR200C |
Synonym | MIRN200C;microRNA 200c;MIR200C;microRNA 200c |
Definition | hsa-mir-200c |
Position | 12p13.31 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406985 |
Links to all GeneRIF Items | 406985 |
Links to iHOP | 406985 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406985 : length: 22 cgtcttacccagcagtgtttgg |
Protein Sequence | >406985 : length: 3 N/A |