General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 406986 |
Name | MIR203A |
Synonym | MIR203|MIRN203|hsa-mir-203a|miR-203|miRNA203;microRNA 203a;MIR203A;microRNA 203a |
Definition | hsa-mir-203|microRNA 203 |
Position | 14q32.33 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
Caution | This gene might be oncogene according to our integrated oncogene list. |
External Links |
|
Links to Entrez Gene | 406986 |
Links to all GeneRIF Items | 406986 |
Links to iHOP | 406986 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406986 : length: 22 gtgaaatgtttaggaccactag |
Protein Sequence |
>406986 : length: 3 N/A |