| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406987 |
Name | MIR204 |
Synonym | MIRN204|miRNA204;microRNA 204;MIR204;microRNA 204 |
Definition | hsa-mir-204 |
Position | 9q21.12 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406987 |
Links to all GeneRIF Items | 406987 |
Links to iHOP | 406987 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406987 : length: 22 ttccctttgtcatcctatgcct |
Protein Sequence | >406987 : length: 3 N/A |