| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406989 |
Name | MIR206 |
Synonym | MIRN206|miRNA206;microRNA 206;MIR206;microRNA 206 |
Definition | hsa-mir-206 |
Position | 6p12.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406989 |
Links to all GeneRIF Items | 406989 |
Links to iHOP | 406989 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406989 : length: 22 tggaatgtaaggaagtgtgtgg |
Protein Sequence |
>406989 : length: 3 N/A |