| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406992 |
Name | MIR210 |
Synonym | MIRN210|mir-210;microRNA 210;MIR210;microRNA 210 |
Definition | hsa-mir-210 |
Position | 11p15.5 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
External Links | |
Links to Entrez Gene | 406992 |
Links to all GeneRIF Items | 406992 |
Links to iHOP | 406992 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406992 : length: 22 ctgtgcgtgtgacagcggctga |
Protein Sequence | >406992 : length: 3 N/A |