| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406995 |
Name | MIR181A1 |
Synonym | MIR213|MIRN181A1|MIRN213|hsa-mir-181a-1|mir-213;microRNA 181a-1;MIR181A1;microRNA 181a-1 |
Definition | hsa-mir-213|microRNA 213 |
Position | 1q32.1 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406995 |
Links to all GeneRIF Items | 406995 |
Links to iHOP | 406995 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406995 : length: 23 aacattcaacgctgtcggtgagt |
Protein Sequence |
>406995 : length: 3 N/A |