| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406996 |
Name | MIR214 |
Synonym | MIRN214|miRNA214|mir-214;microRNA 214;MIR214;microRNA 214 |
Definition | hsa-mir-214 |
Position | 1q24.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 406996 |
Links to all GeneRIF Items | 406996 |
Links to iHOP | 406996 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406996 : length: 22 tgcctgtctacacttgctgtgc |
Protein Sequence |
>406996 : length: 3 N/A |