| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407002 |
Name | MIR219A1 |
Synonym | MIR219-1|MIRN219-1|MRI219-1|hsa-mir-219a-1|mir-219;microRNA 219a-1;MIR219A1;microRNA 219a-1 |
Definition | hsa-mir-219-1|microRNA 219-1 |
Position | 6p21.32 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407002 |
Links to all GeneRIF Items | 407002 |
Links to iHOP | 407002 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407002 : length: 21 tgattgtccaaacgcaattct |
Protein Sequence |
>407002 : length: 3 N/A |