| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407007 |
Name | MIR222 |
Synonym | MIRN222|miRNA222|mir-222;microRNA 222;MIR222;microRNA 222 |
Definition | hsa-mir-222 |
Position | Xp11.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 407007 |
Links to all GeneRIF Items | 407007 |
Links to iHOP | 407007 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407007 : length: 22 ctcagtagccagtgtagatcct |
Protein Sequence |
>407007 : length: 3 N/A |