| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407008 |
Name | MIR223 |
Synonym | MIRN223|miRNA223|mir-223;microRNA 223;MIR223;microRNA 223 |
Definition | hsa-mir-223 |
Position | Xq12 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 407008 |
Links to all GeneRIF Items | 407008 |
Links to iHOP | 407008 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407008 : length: 22 cgtgtatttgacaagctgagtt |
Protein Sequence |
>407008 : length: 3 N/A |