| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407010 |
Name | MIR23A |
Synonym | MIRN23A|hsa-mir-23a|miRNA23A;microRNA 23a;MIR23A;microRNA 23a |
Definition | - |
Position | 19p13.13 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407010 |
Links to all GeneRIF Items | 407010 |
Links to iHOP | 407010 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407010 : length: 22 ggggttcctggggatgggattt |
Protein Sequence | >407010 : length: 3 N/A |