| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407011 |
Name | MIR23B |
Synonym | MIRN23B|hsa-mir-23b|miRNA23B;microRNA 23b;MIR23B;microRNA 23b |
Definition | - |
Position | 9q22.32 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407011 |
Links to all GeneRIF Items | 407011 |
Links to iHOP | 407011 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407011 : length: 22 tgggttcctggcatgctgattt |
Protein Sequence |
>407011 : length: 3 N/A |