| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407012 |
Name | MIR24-1 |
Synonym | MIR189|MIRN24-1|miR-24-1|miRNA24-1;microRNA 24-1;MIR24-1;microRNA 24-1 |
Definition | hsa-mir-24-1 |
Position | 9q22.32 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 407012 |
Links to all GeneRIF Items | 407012 |
Links to iHOP | 407012 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407012 : length: 22 tgcctactgagctgatatcagt |
Protein Sequence |
>407012 : length: 3 N/A |