| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407014 |
Name | MIR25 |
Synonym | MIRN25|hsa-mir-25|miR-25;microRNA 25;MIR25;microRNA 25 |
Definition | - |
Position | 7q22.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407014 |
Links to all GeneRIF Items | 407014 |
Links to iHOP | 407014 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407014 : length: 21 aggcggagacttgggcaattg |
Protein Sequence | >407014 : length: 3 N/A |