| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407015 |
Name | MIR26A1 |
Synonym | MIR26A|MIRN26A1;microRNA 26a-1;MIR26A1;microRNA 26a-1 |
Definition | hsa-mir-26a-1 |
Position | 3p22.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407015 |
Links to all GeneRIF Items | 407015 |
Links to iHOP | 407015 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407015 : length: 22 ttcaagtaatccaggataggct |
Protein Sequence |
>407015 : length: 3 N/A |