| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407016 |
Name | MIR26A2 |
Synonym | MIRN26A2;microRNA 26a-2;MIR26A2;microRNA 26a-2 |
Definition | hsa-mir-26a-2 |
Position | 12q14.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407016 |
Links to all GeneRIF Items | 407016 |
Links to iHOP | 407016 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407016 : length: 22 ttcaagtaatccaggataggct |
Protein Sequence | >407016 : length: 3 N/A |