| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407018 |
Name | MIR27A |
Synonym | MIR27|MIRN27A;microRNA 27a;MIR27A;microRNA 27a |
Definition | hsa-mir-27a |
Position | 19p13.13 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 407018 |
Links to all GeneRIF Items | 407018 |
Links to iHOP | 407018 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407018 : length: 22 agggcttagctgcttgtgagca |
Protein Sequence |
>407018 : length: 3 N/A |