| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407021 |
Name | MIR29A |
Synonym | MIRN29|MIRN29A|hsa-mir-29|hsa-mir-29a|miRNA29A;microRNA 29a;MIR29A;microRNA 29a |
Definition | microRNA 29 |
Position | 7q32.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407021 |
Links to all GeneRIF Items | 407021 |
Links to iHOP | 407021 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407021 : length: 22 actgatttcttttggtgttcag |
Protein Sequence |
>407021 : length: 3 N/A |