General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 407022 |
Name | MIR296 |
Synonym | MIRN296|miRNA296;microRNA 296;MIR296;microRNA 296 |
Definition | hsa-mir-296 |
Position | 20q13.32 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 407022 |
Links to all GeneRIF Items | 407022 |
Links to iHOP | 407022 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407022 : length: 21 agggccccccctcaatcctgt |
Protein Sequence |
>407022 : length: 3 N/A |