| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407026 |
Name | MIR29C |
Synonym | MIRN29C|miRNA29C;microRNA 29c;MIR29C;microRNA 29c |
Definition | hsa-mir-29c |
Position | 1q32.2 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407026 |
Links to all GeneRIF Items | 407026 |
Links to iHOP | 407026 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407026 : length: 22 tgaccgatttctcctggtgttc |
Protein Sequence | >407026 : length: 3 N/A |