General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 407031 |
Name | MIR30C1 |
Synonym | MIRN30C1;microRNA 30c-1;MIR30C1;microRNA 30c-1 |
Definition | hsa-mir-30c-1 |
Position | 1p34.2 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 407031 |
Links to all GeneRIF Items | 407031 |
Links to iHOP | 407031 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407031 : length: 23 tgtaaacatcctacactctcagc |
Protein Sequence |
>407031 : length: 3 N/A |