| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407037 |
Name | MIR320A |
Synonym | MIRN320|MIRN320A|hsa-mir-320a;microRNA 320a;MIR320A;microRNA 320a |
Definition | hsa-mir-320|microRNA 320 |
Position | 8p21.3 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407037 |
Links to all GeneRIF Items | 407037 |
Links to iHOP | 407037 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407037 : length: 22 aaaagctgggttgagagggcga |
Protein Sequence | >407037 : length: 3 N/A |