| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407039 |
Name | MIR33A |
Synonym | MIR33|MIRN33|MIRN33A|hsa-mir-33|hsa-mir-33a|miR-33|miRNA33A;microRNA 33a;MIR33A;microRNA 33a |
Definition | microRNA 33 |
Position | 22q13.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407039 |
Links to all GeneRIF Items | 407039 |
Links to iHOP | 407039 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407039 : length: 21 gtgcattgtagttgcattgca |
Protein Sequence |
>407039 : length: 3 N/A |