| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407041 |
Name | MIR34B |
Synonym | MIRN34B|miRNA34B;microRNA 34b;MIR34B;microRNA 34b |
Definition | hsa-mir-34b |
Position | 11q23.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407041 |
Links to all GeneRIF Items | 407041 |
Links to iHOP | 407041 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407041 : length: 23 taggcagtgtcattagctgattg |
Protein Sequence | >407041 : length: 3 N/A |