| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407042 |
Name | MIR34C |
Synonym | MIRN34C|miRNA34C;microRNA 34c;MIR34C;microRNA 34c |
Definition | hsa-mir-34c |
Position | 11q23.1 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407042 |
Links to all GeneRIF Items | 407042 |
Links to iHOP | 407042 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407042 : length: 23 aggcagtgtagttagctgattgc |
Protein Sequence |
>407042 : length: 3 N/A |