| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407043 |
Name | MIR7-1 |
Synonym | MIRN7-1|hsa-mir-7-1|mir-7-1;microRNA 7-1;MIR7-1;microRNA 7-1 |
Definition | - |
Position | 9q21.32 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407043 |
Links to all GeneRIF Items | 407043 |
Links to iHOP | 407043 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407043 : length: 23 tggaagactagtgattttgttgt |
Protein Sequence | >407043 : length: 3 N/A |