| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407046 |
Name | MIR9-1 |
Synonym | MIRN9-1|hsa-mir-9-1|miRNA9-1;microRNA 9-1;MIR9-1;microRNA 9-1 |
Definition | - |
Position | 1q22 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407046 |
Links to all GeneRIF Items | 407046 |
Links to iHOP | 407046 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407046 : length: 23 tctttggttatctagctgtatga |
Protein Sequence |
>407046 : length: 3 N/A |