| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407047 |
Name | MIR9-2 |
Synonym | MIRN9-2|hsa-mir-9-2|miRNA9-2;microRNA 9-2;MIR9-2;microRNA 9-2 |
Definition | - |
Position | 5q14.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407047 |
Links to all GeneRIF Items | 407047 |
Links to iHOP | 407047 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407047 : length: 23 tctttggttatctagctgtatga |
Protein Sequence |
>407047 : length: 3 N/A |